ID: 1130984492_1130984497

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1130984492 1130984497
Species Human (GRCh38) Human (GRCh38)
Location 15:88836185-88836207 15:88836202-88836224
Sequence CCTCCCCTCTTCCAGGTGAACTA GAACTATGACCACTTTACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 190} {0: 1, 1: 0, 2: 0, 3: 1, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!