ID: 1130990310_1130990319

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1130990310 1130990319
Species Human (GRCh38) Human (GRCh38)
Location 15:88872045-88872067 15:88872089-88872111
Sequence CCATCGAAGGGGACTTCCGCTGG AGTTCTGCTGTAGGCACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 34} {0: 1, 1: 0, 2: 1, 3: 20, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!