ID: 1130990887_1130990892

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1130990887 1130990892
Species Human (GRCh38) Human (GRCh38)
Location 15:88875047-88875069 15:88875066-88875088
Sequence CCTCCTGCCGAGGGTAAGCCGGC CGGCAGGAGAGAGCCATCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 51} {0: 1, 1: 0, 2: 2, 3: 14, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!