ID: 1130991182_1130991193

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1130991182 1130991193
Species Human (GRCh38) Human (GRCh38)
Location 15:88877083-88877105 15:88877119-88877141
Sequence CCAGGTCCTCTGCCACTAGGCCA GGTGAACCATTGAGCAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 185} {0: 1, 1: 0, 2: 2, 3: 26, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!