ID: 1130995521_1130995534

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1130995521 1130995534
Species Human (GRCh38) Human (GRCh38)
Location 15:88901717-88901739 15:88901769-88901791
Sequence CCCAGGGGATTGGCGCATCCTGC GATCCACAGCTCCCAGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64} {0: 1, 1: 1, 2: 1, 3: 34, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!