ID: 1131006952_1131006959

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1131006952 1131006959
Species Human (GRCh38) Human (GRCh38)
Location 15:88986167-88986189 15:88986210-88986232
Sequence CCACCTTAGTCCTCTAATATGCA TCCGAACACATGGTGTTATCTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 15, 3: 56, 4: 264} {0: 1, 1: 11, 2: 16, 3: 12, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!