ID: 1131019967_1131019971

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1131019967 1131019971
Species Human (GRCh38) Human (GRCh38)
Location 15:89089109-89089131 15:89089132-89089154
Sequence CCCTTCGTGAGCTTTTCCCACAG CTAGAGCTGTCCAGCAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 108} {0: 1, 1: 0, 2: 1, 3: 6, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!