|
Left Crispr |
Right Crispr |
| Crispr ID |
1131021201 |
1131021207 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:89100561-89100583
|
15:89100608-89100630
|
| Sequence |
CCTTAGATGTTAAAAAGGAACCT |
GCCTGTAATCCCAGCACTTTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 25, 4: 191} |
{0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|