ID: 1131022670_1131022676

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1131022670 1131022676
Species Human (GRCh38) Human (GRCh38)
Location 15:89112490-89112512 15:89112531-89112553
Sequence CCACAGCCTGGTCCTCTATGACT GACAGATAATAATTGGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 221} {0: 1, 1: 0, 2: 2, 3: 22, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!