ID: 1131032253_1131032266

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1131032253 1131032266
Species Human (GRCh38) Human (GRCh38)
Location 15:89196056-89196078 15:89196087-89196109
Sequence CCAGGTCCCTCCCCTCGGAGAGG CTGGGTCTGGGAAGGAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 207} {0: 1, 1: 1, 2: 8, 3: 74, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!