ID: 1131056298_1131056302

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1131056298 1131056302
Species Human (GRCh38) Human (GRCh38)
Location 15:89377369-89377391 15:89377402-89377424
Sequence CCTGGGGAGGGGGAGCATGTAAA GATTTGAAGGGACCAGGATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!