ID: 1131073439_1131073445

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1131073439 1131073445
Species Human (GRCh38) Human (GRCh38)
Location 15:89480092-89480114 15:89480114-89480136
Sequence CCCTTCCCCCAAAAAGAACTGGC CAGCCATGCACCATACCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 216} {0: 1, 1: 0, 2: 0, 3: 23, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!