ID: 1131073444_1131073453

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1131073444 1131073453
Species Human (GRCh38) Human (GRCh38)
Location 15:89480100-89480122 15:89480136-89480158
Sequence CCAAAAAGAACTGGCAGCCATGC GGGATCAGGTCTGATCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157} {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!