ID: 1131073451_1131073454

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1131073451 1131073454
Species Human (GRCh38) Human (GRCh38)
Location 15:89480129-89480151 15:89480152-89480174
Sequence CCACGTGGGGATCAGGTCTGATC ATGGTGGCCTTCACCCATCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} {0: 2, 1: 0, 2: 1, 3: 8, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!