ID: 1131075078_1131075086

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1131075078 1131075086
Species Human (GRCh38) Human (GRCh38)
Location 15:89490346-89490368 15:89490392-89490414
Sequence CCAGTGTGGGAGAGCTGTGGGTC CTTCCCTCTGAATTTAGCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 182} {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!