ID: 1131079546_1131079556

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1131079546 1131079556
Species Human (GRCh38) Human (GRCh38)
Location 15:89523243-89523265 15:89523279-89523301
Sequence CCCCACCTGGCACTGTGTATGCA CATTTGTTCCCACGTATCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 31, 4: 690}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!