ID: 1131091085_1131091091

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1131091085 1131091091
Species Human (GRCh38) Human (GRCh38)
Location 15:89625366-89625388 15:89625391-89625413
Sequence CCCAGGAGGAAGAGGGCGGTGGG GTGGCGCCGGCTCCTCTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 488} {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!