ID: 1131132835_1131132845

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1131132835 1131132845
Species Human (GRCh38) Human (GRCh38)
Location 15:89911036-89911058 15:89911077-89911099
Sequence CCCCTCCTACAAGGCCACTGGGA TCAGTCTTATCTACAAAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 163} {0: 1, 1: 0, 2: 11, 3: 59, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!