|
Left Crispr |
Right Crispr |
| Crispr ID |
1131147496 |
1131147501 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:90023762-90023784
|
15:90023804-90023826
|
| Sequence |
CCAAGGCAGGTGGATCATTGAGC |
CTAGGCAGCATGGCAAAACCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 18, 2: 125, 3: 523, 4: 5891} |
{0: 1, 1: 6, 2: 77, 3: 330, 4: 892} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|