ID: 1131171798_1131171803

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1131171798 1131171803
Species Human (GRCh38) Human (GRCh38)
Location 15:90184470-90184492 15:90184517-90184539
Sequence CCTTGTGAGATCTCTAGTGTTCT CTCCAGGCTCAGAGAGGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 160} {0: 1, 1: 0, 2: 6, 3: 64, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!