ID: 1131185834_1131185835

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1131185834 1131185835
Species Human (GRCh38) Human (GRCh38)
Location 15:90273498-90273520 15:90273515-90273537
Sequence CCTGCAAATATCTGATCATGCCA ATGCCATACCCTTTTCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132} {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!