ID: 1131188538_1131188551

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1131188538 1131188551
Species Human (GRCh38) Human (GRCh38)
Location 15:90294812-90294834 15:90294861-90294883
Sequence CCCACCGGGCCCTGCAGGGGGCC CTGGCATAGGCCAAGAAGGGTGG
Strand - +
Off-target summary {0: 6, 1: 4, 2: 4, 3: 33, 4: 274} {0: 1, 1: 0, 2: 9, 3: 27, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!