ID: 1131188538_1131188552

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1131188538 1131188552
Species Human (GRCh38) Human (GRCh38)
Location 15:90294812-90294834 15:90294862-90294884
Sequence CCCACCGGGCCCTGCAGGGGGCC TGGCATAGGCCAAGAAGGGTGGG
Strand - +
Off-target summary {0: 6, 1: 4, 2: 4, 3: 33, 4: 274} {0: 1, 1: 1, 2: 6, 3: 29, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!