ID: 1131227212_1131227216

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1131227212 1131227216
Species Human (GRCh38) Human (GRCh38)
Location 15:90634755-90634777 15:90634791-90634813
Sequence CCACTCTCTGACTGAGTATTGGT GCTAAAACTGTAACCAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 134} {0: 1, 1: 7, 2: 8, 3: 13, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!