ID: 1131239837_1131239839

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1131239837 1131239839
Species Human (GRCh38) Human (GRCh38)
Location 15:90729709-90729731 15:90729725-90729747
Sequence CCTTTGTCATGTAACCAAGCATA AAGCATATTCACAACATCCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 70, 4: 270} {0: 1, 1: 0, 2: 3, 3: 22, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!