ID: 1131248645_1131248654

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1131248645 1131248654
Species Human (GRCh38) Human (GRCh38)
Location 15:90817085-90817107 15:90817110-90817132
Sequence CCCTCAGGGTCGCAGGCTGTGCC CAGGAGCTCCCAGGGCTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 87, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!