ID: 1131257602_1131257620

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1131257602 1131257620
Species Human (GRCh38) Human (GRCh38)
Location 15:90872161-90872183 15:90872209-90872231
Sequence CCCGCCCGCACACCTGTGCGGCC CGCCGGCGGCCGGCGCAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 174} {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!