ID: 1131260233_1131260259

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1131260233 1131260259
Species Human (GRCh38) Human (GRCh38)
Location 15:90884205-90884227 15:90884254-90884276
Sequence CCTTGCGCCCCTTCCCGGTGTTC TGCGGGGCGCGGGCGGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100} {0: 1, 1: 0, 2: 1, 3: 20, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!