ID: 1131261957_1131261975

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1131261957 1131261975
Species Human (GRCh38) Human (GRCh38)
Location 15:90892197-90892219 15:90892245-90892267
Sequence CCCTGCCCCATCTGATTCCCCAC CCCACCACACACCATCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 314} {0: 1, 1: 0, 2: 4, 3: 41, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!