ID: 1131265104_1131265123

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1131265104 1131265123
Species Human (GRCh38) Human (GRCh38)
Location 15:90911052-90911074 15:90911101-90911123
Sequence CCTTCCCCATCCGGATGAGTTCT CCTGGGACAGGTGGGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 107} {0: 2, 1: 0, 2: 20, 3: 134, 4: 999}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!