ID: 1131275699_1131275706

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1131275699 1131275706
Species Human (GRCh38) Human (GRCh38)
Location 15:90978806-90978828 15:90978824-90978846
Sequence CCATCCTGGCCCTGAAGATGAGG TGAGGTCCACCCTTAGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 286} {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!