ID: 1131277475_1131277483

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1131277475 1131277483
Species Human (GRCh38) Human (GRCh38)
Location 15:90994277-90994299 15:90994303-90994325
Sequence CCCTCGGCGCCGACTGCCGTGAC CTAGGCCCGGGACCCCGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20} {0: 1, 1: 0, 2: 0, 3: 15, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!