ID: 1131302929_1131302936

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1131302929 1131302936
Species Human (GRCh38) Human (GRCh38)
Location 15:91215349-91215371 15:91215368-91215390
Sequence CCCTCCTCCTTCTGTTTTAGCAG GCAGTTTTGGAATGGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 339} {0: 1, 1: 0, 2: 2, 3: 23, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!