ID: 1131330142_1131330146

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1131330142 1131330146
Species Human (GRCh38) Human (GRCh38)
Location 15:91490489-91490511 15:91490526-91490548
Sequence CCTGGGGCACACAACCATGGATG TAGGAGACTAAACTATGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!