ID: 1131349754_1131349757

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1131349754 1131349757
Species Human (GRCh38) Human (GRCh38)
Location 15:91688403-91688425 15:91688434-91688456
Sequence CCACACACTGTTTGATTCCACTT TGTTCAGAATAGGCATCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 199, 4: 870} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!