|
Left Crispr |
Right Crispr |
| Crispr ID |
1131380416 |
1131380422 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:91959087-91959109
|
15:91959133-91959155
|
| Sequence |
CCATAAAAAGGAACGAAATAATG |
GCTGGAGGCTGTTATTCTAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 43, 1: 849, 2: 2034, 3: 5728, 4: 9941} |
{0: 1, 1: 2, 2: 16, 3: 56, 4: 244} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|