ID: 1131390450_1131390460

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1131390450 1131390460
Species Human (GRCh38) Human (GRCh38)
Location 15:92043881-92043903 15:92043906-92043928
Sequence CCTCCCTCCTCCTGTTTCTCCCT TCGGTTTTTCCATCCCCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 35, 3: 340, 4: 2902} {0: 1, 1: 0, 2: 1, 3: 3, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!