ID: 1131393362_1131393371

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1131393362 1131393371
Species Human (GRCh38) Human (GRCh38)
Location 15:92067305-92067327 15:92067323-92067345
Sequence CCCTCCTCCCTCTGCTTCCCGTG CCGTGTGGTTTCTTCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 91, 4: 981} {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!