ID: 1131406418_1131406425

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1131406418 1131406425
Species Human (GRCh38) Human (GRCh38)
Location 15:92168595-92168617 15:92168635-92168657
Sequence CCTAGCGGCTGAGCATAGGTGAG AGACTGCTGTAGCATGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81} {0: 1, 1: 0, 2: 0, 3: 10, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!