ID: 1131431926_1131431932

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1131431926 1131431932
Species Human (GRCh38) Human (GRCh38)
Location 15:92394571-92394593 15:92394595-92394617
Sequence CCTTGGCAAAGTGGGCAGGGGGC CGCAGGGATCTCTGAGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 281} {0: 1, 1: 0, 2: 0, 3: 18, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!