ID: 1131438070_1131438082

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1131438070 1131438082
Species Human (GRCh38) Human (GRCh38)
Location 15:92438771-92438793 15:92438818-92438840
Sequence CCTCCAATGTCCAGAATGTACCT GAGGGGAAGAGAGGCGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 141} {0: 1, 1: 0, 2: 2, 3: 80, 4: 736}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!