ID: 1131469099_1131469103

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1131469099 1131469103
Species Human (GRCh38) Human (GRCh38)
Location 15:92680500-92680522 15:92680552-92680574
Sequence CCTGGAAAGTAAGCTGCCAGTAC TATCCCATTCCCATTGTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137} {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!