ID: 1131505190_1131505198

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1131505190 1131505198
Species Human (GRCh38) Human (GRCh38)
Location 15:93011694-93011716 15:93011738-93011760
Sequence CCTGTCTCATCATATCATTCCCC TAGGGTGAACATAATGGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 170} {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!