ID: 1131517612_1131517631

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1131517612 1131517631
Species Human (GRCh38) Human (GRCh38)
Location 15:93089322-93089344 15:93089357-93089379
Sequence CCGCGGGCGGGGGGCGCGCGCGG GGGAGGGGCGGGGAGGAGCGGGG
Strand - +
Off-target summary No data {0: 4, 1: 21, 2: 199, 3: 2859, 4: 7367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!