ID: 1131638507_1131638510

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1131638507 1131638510
Species Human (GRCh38) Human (GRCh38)
Location 15:94263572-94263594 15:94263596-94263618
Sequence CCTTCTGTCCTTAGGAACACCAG CAACACTACAGCTTTATGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 215} {0: 1, 1: 0, 2: 2, 3: 12, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!