ID: 1131652172_1131652179

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1131652172 1131652179
Species Human (GRCh38) Human (GRCh38)
Location 15:94412011-94412033 15:94412062-94412084
Sequence CCCATTGGTGTTAGGCAAGACCC ATGGAGCCACAGAATGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 48} {0: 1, 1: 1, 2: 7, 3: 27, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!