ID: 1131748926_1131748928

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1131748926 1131748928
Species Human (GRCh38) Human (GRCh38)
Location 15:95484533-95484555 15:95484568-95484590
Sequence CCAGTAATGGAGGAAATTATGGC GGCAAAAATCTTCCATTATTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!