ID: 1131796629_1131796635

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1131796629 1131796635
Species Human (GRCh38) Human (GRCh38)
Location 15:96024320-96024342 15:96024373-96024395
Sequence CCATCATACTTCTAGTTGGAGAG CTCCTTTGCAATTCTGGATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!