ID: 1131828343_1131828347

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1131828343 1131828347
Species Human (GRCh38) Human (GRCh38)
Location 15:96337529-96337551 15:96337547-96337569
Sequence CCGTTTGGTAGGTAAAACCCCCA CCCCATCGAAACCCTCATCCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 3, 4: 73} {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!