ID: 1131830520_1131830527

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1131830520 1131830527
Species Human (GRCh38) Human (GRCh38)
Location 15:96352077-96352099 15:96352111-96352133
Sequence CCGGGGGGGTGGGGCGTGGAGGG CCGCGCCTGGCCCCTGCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 53, 4: 498}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!